Basic ios clear iostream error - Исправление ошибок и поиск оптимальных решений проблем

I am encountering a situation that I don’t quite know where to look after the cause of the issue for, as the problem seems to only occur when piping the program output from the terminal into a file and I have no idea what that might have to do with my code itself. Furthermore this only happens for larger files and not for small ones;

I wrote a file reader class with an output iterator:

#include <fstream>
#include <iostream>
#include <limits>

class Filereader
{
private:
    std::fstream file;

    class output_iterator
    {

    public:
        output_iterator(std::fstream& file, int line_number)
          : file(file), line_number(line_number)
        {
            if (line_number == 0 || line_number == -1) {
            } else {
                go_to_line(line_number);
            }
        }

        const std::string& operator*() const { return line; }

        output_iterator& operator++()
        {
            if (file.good()) {
                getline(file, line);
                line_number++;
            } else {
                line_number = -1;
            }
            return *this;
        }

        friend bool operator!=(const output_iterator& lhs,
                               const output_iterator& rhs)
        {
            return !(lhs == rhs);
        }

        friend bool operator==(const output_iterator& lhs,
                               const output_iterator& rhs)
        {
            if (&lhs.file != &rhs.file)
                throw(std::invalid_argument("file operands do not match"));
            return lhs.line_number == rhs.line_number;
        }

    private:
        void go_to_line(size_t num)
        {
            file.seekg(0, std::ios::beg);
            for (size_t i = 0; i < num - 1; ++i) {
                file.ignore(std::numeric_limits<std::streamsize>::max(), 'n');
            }
        }

    private:
        std::fstream& file;
        std::string   line;
        int           line_number;
    };

public:
    Filereader(const std::string& filename)
    {
        file.exceptions(std::fstream::failbit | std::fstream::badbit);
        try {
            file.open(filename, std::ios::in);
        } catch (const std::fstream::failure& e) {
            std::cerr << "exception opening file '" + filename + "'"
                      << "n";
        }
    }

    output_iterator begin() { return output_iterator(file, 0); }
    output_iterator end() { return output_iterator(file, -1); }
};

and my test program is this:

int main(int argc, char** argv){

    Filereader fr(argv[1]);

    for (auto i = fr.begin(); i != fr.end(); ++i){
        std::cout << *i << "n";
    }
}

Now, piping the output actually goes through successfully, but after that the following error is thrown:

terminate called after throwing an instance of 'std::ios_base::failure[abi:cxx11]'
  what():  basic_ios::clear: iostream error

And as mentioned this only happens for larger files.

When not piping the output, no error is being thrown…
I am probably missing something really obvious here, but I don’t know where to look for the cause of this.

Источник

I have tried to run AdapterRemoval on two operating systems, and have received the following error on both:

Trimming paired end reads …
Opening FASTQ file ‘PCS_S21_L001_R1_001.fastq’, line numbers start at 1
Opening FASTQ file ‘PCS_S21_L001_R2_001.fastq’, line numbers start at 1
ERROR: Unhandled exception in thread:
basic_ios::clear: iostream error
ERROR: AdapterRemoval did not run to completion;
do NOT make use of resulting trimmed reads!

The first os was macOS Catalina v10.15.1, while the second was on a server and was CentOS Linux v7. I’m not sure how to handle the error?

Hi,

What version of AdapterRemoval are you using and what command-line arguments did you use when running it?

Hi,
Thanks for the quick response.

This was a conda install: AdapterRemoval v.2.3.0

Command:
AdapterRemoval —threads 2 —file1 PCS1_S1_L001_R1_001.fastq —file2 PCS1_S1_L001_R2_001.fastq —minalignmentlength 10 —trimns —trimqualities —minquality 20 —collapse —minlength 30 —output1 ./analyis_ready/PCS1.trimmed.R1.fastq —output2 ./analysis_ready/PCS1.trimmed.R2.fastq —outputcollapsed ./analysis_ready/PCS1.trimmed.merged.fastq —settings PCS1_AdapterRemoval.txt —adapter1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNGCATCTCGTATGCCGTCTTCTGCT —adapter2 AGATCGGAAGAGCGTCGGTAGGGAAAGAGTGTAGTCTGTGGTGTAGATCTCGGTGGTC

I am not sure why the error message is so uninformative, and I am currently exploring how to fix that, but the cause is most likely that AdapterRemoval cannot create the output file, possibly because the directory «analysis_ready» does not exist or because you do not have sufficient permissions to write to it.

Can you check if «analysis_ready» exists and that you have permission to write to it? I.e. what is the output of running the following command in the same folder where you are running AdapterRemoval:

    touch ./analyis_ready/PCS1.trimmed.R1.fastq

Actually, this is silly, but apparently this is a simple typo error. I have «analysis_ready» in one spot and «analyis_ready» in another. It is now working. Sorry about that. I should have caught that.

Also, thank you for your time.

You’re welcome. I’ll release a small update to AdapterRemoval sometime this week to improve the error message; it’s easy to make a typo like that, so the error message should at least point in the right direction and not be this uninformative.

Источник

Содержание

basic_ios::clear: iostream error #42
Comments
Footer
std:: basic_ios::clear
Parameters
Return Value
Example
C++ IOstream Library и вывод сообщений об ошибках
Re: C++ IOstream Library и вывод сообщений об ошибках
Re: C++ IOstream Library и вывод сообщений об ошибках
Re: C++ IOstream Library и вывод сообщений об ошибках
terminate called after throwing an instance of ‘std::ios_base::failure[abi:cxx11]’ #612
Comments
Problem
Steps to Reproduce
Versions
Footer
std:: basic_ios::exceptions

basic_ios::clear: iostream error #42

I have tried to run AdapterRemoval on two operating systems, and have received the following error on both:

Trimming paired end reads .
Opening FASTQ file ‘PCS_S21_L001_R1_001.fastq’, line numbers start at 1
Opening FASTQ file ‘PCS_S21_L001_R2_001.fastq’, line numbers start at 1
ERROR: Unhandled exception in thread:
basic_ios::clear: iostream error
ERROR: AdapterRemoval did not run to completion;
do NOT make use of resulting trimmed reads!

The first os was macOS Catalina v10.15.1, while the second was on a server and was CentOS Linux v7. I’m not sure how to handle the error?

The text was updated successfully, but these errors were encountered:

What version of AdapterRemoval are you using and what command-line arguments did you use when running it?

Hi,
Thanks for the quick response.

This was a conda install: AdapterRemoval v.2.3.0

Also, thank you for your time.

You can’t perform that action at this time.

You signed in with another tab or window. Reload to refresh your session. You signed out in another tab or window. Reload to refresh your session.

Источник

std:: basic_ios::clear

Sets a new value for the stream’s internal error state flags.

The current value of the flags is overwritten: All bits are replaced by those in state ; If state is goodbit (which is zero) all error flags are cleared.

In the case that no stream buffer is associated with the stream when this function is called, the badbit flag is automatically set (no matter the value for that bit passed in argument state ).

Note that changing the state may throw an exception, depending on the latest settings passed to member exceptions .

The current state can be obtained with member function rdstate.

Parameters

state An object of type ios_base::iostate that can take as value any combination of the following state flag member constants:

iostate value (member constants)	indicates	functions to check state flags
good()	eof()	fail()	bad()	rdstate()
goodbit	No errors (zero value iostate )	true	false	false	false	goodbit
eofbit	End-of-File reached on input operation	false	true	false	false	eofbit
failbit	Logical error on i/o operation	false	false	true	false	failbit
badbit	Read/writing error on i/o operation	false	false	true	true	badbit

eofbit , failbit and badbit are member constants with implementation-defined values that can be combined (as if with the bitwise OR operator).
goodbit is zero, indicating that none of the other bits is set.

Return Value

Example

In this example, myfile is open for input operations, but we perform an output operation on it, so failbit is set. The example calls then clear in order to remove the flag and allow further operations like getline to be attempted on myfile .

Источник

C++ IOstream Library и вывод сообщений об ошибках

Есть следующий C++ код:

Есть ли в C++ какие-либо средства для получения строкового представления ошибок iostream?

Re: C++ IOstream Library и вывод сообщений об ошибках

Попробуй, что-либо, навроде —

#include
#include
#include

int main(void)
<
std::fstream file;
file.exceptions(std::ios::badbit | std::ios::failbit);
try
<
file.open(«/test_file», std::ios::out);
if (!file.is_open ())
throw (std::ios::failure («Permission denied»));

>
catch(std::ios::failure &e)
<
std::cout ★★★★★ ( 19.01.09 23:55:13 MSK )

Re: C++ IOstream Library и вывод сообщений об ошибках

> throw (std::ios::failure («Permission denied»));

ну тогда уж хотя бы так:

.
throw (std::ios::failure (::strerror(errno)));

но это всё равно не то. если обрабатывать ошибки вручную, то исключения в данном случае не нужны. скорее, наоборот, лишь усложняют и запутывают картину.

Re: C++ IOstream Library и вывод сообщений об ошибках

>но это всё равно не то. если обрабатывать ошибки вручную, то исключения в данном случае не нужны. скорее, наоборот, лишь усложняют и запутывают картину.

Да это понятно, что это не тот случай, но топикстартер сам желал увидеть как бы это могло выглядеть в принципе.

Источник

terminate called after throwing an instance of ‘std::ios_base::failure[abi:cxx11]’ #612

Problem

I run the reconstruction from the console and get the error terminate called after throwing an instance of ‘std::ios_base::failure[abi:cxx11]’ what(): basic_ios::clear: iostream error when i use more 200 images.

Expected behavior:

Actual behavior:

Steps to Reproduce

[First Step]
[Second Step]
[and so on. ]

Versions

AliceVision branch/version: last version
OS: Ubuntu
C++ compiler: gcc 5.4.0

The text was updated successfully, but these errors were encountered:

Can you run ulimit -a in the terminal and paste the output here?

@zvrba Here is the output of the command:

Ok, I thought that the problem could be caused by the process having a low limit on open files, but it’s 1024 which is well above 200. (In case there was a bug where opened files were never closed.)

@zvrba I even increased the file limit to 500,000, but I still get this error.

It has problems loading multiple files. I have never seen this error.
Do you have special characters in your paths? Meshroom installation folder, images folders of your dataset or meshroom project folder?

Have you found a solution?
When we use more than 200 images, we use the vocabulary tree. Could you check that this file is not corrupted? Maybe download it again and on another storage.
If it doesn’t work, a workaround, could be to not use the vocabularytree in the ImageMatching (set ImageMatching.nbMatches to 0). It will slow down the reconstruction process on large datasets, but at least it should work.

This issue has been automatically marked as stale because it has not had recent activity. It will be closed if no further activity occurs. Thank you for your contributions.

You can’t perform that action at this time.

You signed in with another tab or window. Reload to refresh your session. You signed out in another tab or window. Reload to refresh your session.

Источник

std:: basic_ios::exceptions

The first form (1) returns the current exception mask for the stream.

The second form (2) sets a new exception mask for the stream and clears the stream’s error state flags (as if member clear() was called).

The exception mask is an internal value kept by all stream objects specifying for which state flags an exception of member type failure (or some derived type) is thrown when set. This mask is an object of member type iostate , which is a value formed by any combination of the following member constants:

iostate value (member constants)	indicates	functions to check state flags
good()	eof()	fail()	bad()	rdstate()
goodbit	No errors (zero value iostate )	true	false	false	false	goodbit
eofbit	End-of-File reached on input operation	false	true	false	false	eofbit
failbit	Logical error on i/o operation	false	false	true	false	failbit
badbit	Read/writing error on i/o operation	false	false	true	true	badbit

eofbit , failbit and badbit are member constants with implementation-defined values that can be combined (as if with the bitwise OR operator), so that the stream throws when any of the selected error state flags is set.
goodbit is zero, indicating that no exceptions shall be thrown when an error state flags is set.

All streams have goodbit by default (they do not throw exceptions due to error state flags being set).

Источник

Home
Software Programming
Why is the exception message when the open failure of the stream becomes basic_ios::clear?

This topic has been deleted. Only users with topic management privileges can see it.

I want to detect file open errors in the following code.

#include <iostream>
#include <fstream>
int main()

{

std::ofstream fout;
try
{
    fout.exceptions(std::ofstream::failbit);
    fout.open("/tmp/hoge/hoge.txt");
}
catch(const std::ofstream::failure e)
{
    std::cout &lt;&lt; "msg=" &lt;&lt; e.what() &lt;&lt; std::endl;
}

return 0;

}


 result is
$ ./a.out

msg=basic_ios::clear


Contact
msg=basic_ios::failbit


basic_ios::clear
Or is there a mistake in my implementation?

std::ios_base::failure::what()Home https://cpprefjp.github.io/reference/ios/basic_ios/exceptions.html is not fixed, so it is implementation dependency of the standard library.

https://wandbox.org/permlink/FDtRzu3FoITc8jvN :

msg=basic_ios:clear: iostream error

https://wandbox.org/permlink/xsR8XX1CQnZAJPOp :

msg=ios_base:clear: unspecified iostream_category error

Visual C++ 2017

msg=ios_base::failbit set: iostream error

1 / 1

[edit] Parameters

state

—

new error state flags setting. It can be a combination of the following constants:

Constant	Explanation
goodbit	no error
badbit	irrecoverable stream error
failbit	input/output operation failed (formatting or extraction error)
eofbit	associated input sequence has reached end-of-file

[edit] Return value

(none)

[edit] Exceptions

If the new error state includes a bit that is also included in the exceptions() mask, throws an exception of type failure.

[edit] Example

clear() without arguments can be used to unset the failbit after unexpected input; for std::cin.putback(c) see ungetc.

#include <iostream>
#include <string>
 
int main()
{
    for (char c : {'n', '4', '1', '.', '3', 'n', 'Z', 'Y', 'X'})
        std::cin.putback(c); // emulate user's input (not portable: see ungetc Notes)
 
    double n;
    while (std::cout << "Please, enter a number: " && !(std::cin >> n))
    {
        std::cin.clear();
        std::string line;
        std::getline(std::cin, line);
        std::cout << line << "nI am sorry, but '" << line << "' is not a numbern";
    }
    std::cout << n << "nThank you for entering the number " << n << 'n';
}

Output:

Please, enter a number: XYZ
I am sorry, but 'XYZ' is not a number
Please, enter a number: 3.14
Thank you for entering the number 3.14

[edit] Defect reports

The following behavior-changing defect reports were applied retroactively to previously published C++ standards.

DR	Applied to	Behavior as published	Correct behavior
LWG 412	C++98	an excption would be thrown if the current error state includes a bit that is also included in the exceptions() mask	checks the new error state instead

[edit] See also

Источник

Я сталкиваюсь с ситуацией, в которой я не совсем знаю, где искать причину проблемы, так как проблема, кажется, возникает только при передаче выходных данных программы из терминала в файл, и я понятия не имею, что это может иметь делать с моим кодом сам. Кроме того, это происходит только для больших файлов, а не для маленьких;

Я написал класс для чтения файлов с выходным итератором:

#include <fstream>
#include <iostream>
#include <limits>

class Filereader
{
private:
std::fstream file;

class output_iterator
{

public:
output_iterator(std::fstream& file, int line_number)
: file(file), line_number(line_number)
{
if (line_number == 0 || line_number == -1) {
} else {
go_to_line(line_number);
}
}

const std::string& operator*() const { return line; }

output_iterator& operator++()
{
if (file.good()) {
getline(file, line);
line_number++;
} else {
line_number = -1;
}
return *this;
}

friend bool operator!=(const output_iterator& lhs,
const output_iterator& rhs)
{
return !(lhs == rhs);
}

friend bool operator==(const output_iterator& lhs,
const output_iterator& rhs)
{
if (&lhs.file != &rhs.file)
throw(std::invalid_argument("file operands do not match"));
return lhs.line_number == rhs.line_number;
}

private:
void go_to_line(size_t num)
{
file.seekg(0, std::ios::beg);
for (size_t i = 0; i < num - 1; ++i) {
file.ignore(std::numeric_limits<std::streamsize>::max(), 'n');
}
}

private:
std::fstream& file;
std::string   line;
int           line_number;
};

public:
Filereader(const std::string& filename)
{
file.exceptions(std::fstream::failbit | std::fstream::badbit);
try {
file.open(filename, std::ios::in);
} catch (const std::fstream::failure& e) {
std::cerr << "exception opening file '" + filename + "'"<< "n";
}
}

output_iterator begin() { return output_iterator(file, 0); }
output_iterator end() { return output_iterator(file, -1); }
};

и моя тестовая программа такова:

int main(int argc, char** argv){

Filereader fr(argv[1]);

for (auto i = fr.begin(); i != fr.end(); ++i){
std::cout << *i << "n";
}
}

Теперь конвейерный вывод действительно проходит успешно, но после этого выдается следующая ошибка:

terminate called after throwing an instance of 'std::ios_base::failure[abi:cxx11]'
what():  basic_ios::clear: iostream error

И, как уже упоминалось, это происходит только для больших файлов.

Когда не передается вывод, не выдается никакой ошибки …
Я, вероятно, упускаю что-то действительно очевидное здесь, но я не знаю, где искать причину этого.

Решение

Задача ещё не решена.

Другие решения

Других решений пока нет …

Источник

std::basic_ios<CharT,Traits>::clear

void clear( std::ios_base::iostate state = std::ios_base::goodbit );

Sets the stream error state flags by assigning them the value of state. By default, assigns std::ios_base::goodbit which has the effect of clearing all error state flags.

If rdbuf() is a null pointer (i.e. there is no associated stream buffer), then state | badbit is assigned.

Parameters

state

—

new error state flags setting. It can be a combination of the following constants:

Constant	Explanation
`goodbit`	no error
`badbit`	irrecoverable stream error
`failbit`	input/output operation failed (formatting or extraction error)
`eofbit`	associated input sequence has reached end-of-file

Return value

(none).

Exceptions

If the new error state includes a bit that is also included in the exceptions() mask, throws an exception of type failure.

Example

clear() without arguments can be used to unset the failbit after unexpected input; for std::cin.putback(c) see ungetc.

#include <iostream>
#include <string>
 
int main()
{
    for (char c : {'n', '4', '1', '.', '3', 'n', 'Z', 'Y', 'X'})
        std::cin.putback(c); // emulate user's input (not portable: see ungetc Notes)
 
    double n;
    while( std::cout << "Please, enter a number: " && ! (std::cin >> n) )
    {
        std::cin.clear();
        std::string line;
        std::getline(std::cin, line);
        std::cout << line << "nI am sorry, but '" << line << "' is not a numbern";
    }
    std::cout << n << "nThank you for entering the number " << n << 'n';
}

Output:

Please, enter a number: XYZ
I am sorry, but 'XYZ' is not a number
Please, enter a number: 3.14
Thank you for entering the number 3.14

	sets state flags (public member function)
	returns state flags (public member function)

basic_ios::clear: iostream error #42

std:: basic_ios::clear

Parameters

Return Value

Example

C++ IOstream Library и вывод сообщений об ошибках

Re: C++ IOstream Library и вывод сообщений об ошибках

Re: C++ IOstream Library и вывод сообщений об ошибках

Re: C++ IOstream Library и вывод сообщений об ошибках

terminate called after throwing an instance of ‘std::ios_base::failure[abi:cxx11]’ #612

Problem

Steps to Reproduce

Versions

std:: basic_ios::exceptions

Suggested Topics

[edit] Parameters

[edit] Return value

[edit] Exceptions

[edit] Example

[edit] Defect reports

[edit] See also

Решение

Другие решения

std::basic_ios<CharT,Traits>::clear

Parameters

Return value

Exceptions

Example

See also